(Continued from the first part of this post: “Lactation, Lips, and Other Mammalian Curiosities”)
Now, consider the facts in the first part of this post about the mammalian milk bar and take a look at these orphan elephants at the David Sheldrick Wildlife Trust in Nairobi. I visited these trunky critters with Kathleen and Louise on Saturday, before we left for Laikipia early on Sunday. These young pachyderms find themselves without a mom to care for them due to poaching, illness, or other natural causes. The fine folks at the elephant orphanage take in these little duders from all over Kenya, from Turkana to Tsavo, and care for them until just about weaning time, when they are reintegrated into the wild elephant populations around the country. Without these folks, these little elephants wouldn’t stand a chance. It took Dr. Dame Daphne Sheldrick, animal behaviorist extraordinaire and wife of the man for whom the trust is named, twenty years to perfect the synthetic formula. Cow milk just doesn’t do it for elephants. Each mammalian species produces milk especially formulated for the needs of its young. The rapid growth required by young blue whales, for example, is such that the fat and hormone content of the mother blue whale’s milk would make your indulgent gelato look like diet fare and cause a Major League baseball player to blush, respectively. Similarly, these elephants require a whole mess of nutrients that only elephant milk or a specially concocted substitute may provide. Since the folks at the Wharton School of Business have decided that the start-up elephant dairy I’ve proposed is not feasible in the current economic climate, the later option will have to do. These elephants seem to like it.
David Sheldrick Wildlife Trust Elephants 1/2
Of course, lactation is not forever. Eventually, these kiddos, like all mammals, move on to sweeter meats, so to say. For all mammals except humans, weaning signals the end of lifetime milk consumption. This shift is not only behavioral, but also implicates an enzyme in the stomach known as lactase. Lactase has the job of breaking down the milk sugar lactose. Evolution, being a thrifty process, has produced critters that stop creating lactase after weaning, as no more lactose is ingested after weaning and thus there is no need for the body to expend energy and resources making an unnecessary enzyme. Only in human populations that have practiced dairying for thousands of years is the above condition changed. In these select groups of bipedal primates, lactase is produced throughout life.
David Sheldrick Wildlife Trust Elephants 2/2
As anyone with lactose intolerance can tell you, it isn’t fatal to ingest lactose if you don’t have lactase. It just makes for an interesting gastrointestinal experience. If you’re in a place where food is scarce or even a few extra nutrients matter, the ingestion of milk from dairy animals will give you a hefty evolutionary advantage. So people did it. All the better, and all the more evolutionarily advantageous, if you happen to produce even just a little lactase as an adult. If you produce lactase and break down some of the lactose, you have access to nutrients unavailable to the lactose intolerant. As almost all traits vary in populations, the ability to produce lactase is not binary, either on or off. Instead, it’s continuous, and some people did produce a small amount naturally by luck of the genetic draw. As some elementary Darwinian logic shows, this trait of increasing and persistent lactase production in adulthood, after weaning, will become more prevalent in populations which have access to milk throughout life. The cultural practice of dairying coevolves with the persistence of lactase production after weaning. Interestingly enough, this idea isn’t just some wackadoo academic theory. It happened, and it happened multiple times in separate places. If you’re of northern European stock like myself, you probably ingest lactase like nobody’s business, as we’ve been squeezing udders for millennia. Not so for East Asians, who have not traditionally practiced dairying and thus have a low prevalence of the gene for lactase persistence, as it’s called, in their population. Another place where lactase persistence occurs separately is East Africa, although much later than northern Europe.
The exact details of when this happened is a little sketchy for East Africa, but we do know that the trait of lactase persistence evolved separately here from other places like northern Europe because the genetic basis of the change is different in East Africans and other lactose tolerant populations. Although the same gene is affected, there are different SNPs (single nucleotide polymorphisms) that switch lactase production on. To explain a bit more extensively for those who have been napping in biology class, genes are just a long string of nucleotides, little nubbins on your chromosomes, commonly abbreviated A, C, T, and G. To make things simple, let’s say that genes contain instructions for making proteins, such as the enzyme lactase. Of course, the story is more complex than the way I’m presenting it here, but for our present purposes, it’s a useful fiction.
Let’s say that the gene for making lactase is twenty nucleotides long. Here’s our hypothetical lactase gene:
ATCGATCGATCGATCGATCG
Got it?
Ok. Now, let’s say that the above code is for people who stop producing lactase after weaning. This code is the plesiomorphic, or ancestral, state for all mammals. In northern Europeans, the following change happened:
CTCGATCGATCGATCGATCG
Notice how the first position is now a C rather than an A.
Okay?
Okay. This change causes the gene to continue lactase production after weaning. As we discussed above, this change spread throughout the population because it was very evolutionarily advantageous, which just means that it helped you have more kids because you could get more nutrients, have strong bones and teeth, or were just really sexy in that milk mustache.
Now, here’s the thing. In East Africans, our hypothetical gene looks like this:
ATCGATCGATCGATCGATCA
Notice how the last position is now an A rather than a G. Notice how the first position is like the ancestral position and not like the northern European condition wherein the first nucleotide A is switched to C. Since you inherit these genetic changes, this situation indicates that Africans and Europeans developed their differences in this gene after the two groups were geographically separated. Of course, there’s admixture between groups (which is the geneticist’s way of saying that people from all sorts of different groups have… fun… with each other), but the epicenter of each respective change is geographically separate, so that the frequency of the African form of the gene is at a very high percentage of the population only in Africa and the European form is at a very high percentage of the population only in Europe. Copasetic? Cool.
Also, and this is blow-your-socks-off-awesome, we know that these two separate genetic differences at the nucleotide level produce the same functional difference as the change in northern Europeans: East Africans are lactose tolerant, just like northern Europeans, but the genetic changes are different. And we know it happened for the same cultural reasons.
Here’s the shorter version:
East Africans evolved the ability to digest milk after weaning separately from other human populations that can also digest milk after weaning.
(The short version isn’t as fun, in my opinion.)
Here’s the question I’m interested in answering with this project:
When did this happen?
Genes aren’t so hot at giving exact dates for when these sorts of changes occur, although they can give a rough estimate. If you’re really curious, ask me sometime about the details of dating genetic changes. I also happen to know a whole slew of jokes about genetics that are not kosher for public consumption and it’s really killing me not to be able to post them. Just ask. Anyway, what you need to know is that we can use archaeology to figure out when these things happened. Stratigraphic, cultural, faunal, and radiographic measurements of dates can help us figure out the nitty-gritty details of the date of this change in East Africans. Answering the questions of how this genetic change was related to things like local herding practices, diet and health, environmental conditions, and much, much more can only be answered when we have a solid date for lactase persistence in East Africans.
And just like that, all covert-like, I present to you the “why?” of this project. When did East Africans develop lactase persistence? Among other things, that question is one we’re attempting to help answer. Getting anywhere close to figuring this thing out will not only involve genetics, skeletal biology, archaeology, and ethnohistory, but a lot of hard work and clear thinking. We’re on it, folks.
*****
Okay. I’ve worn myself out with all the science. I’ve got more to blog about, but I’ll do some tomorrow. I did some digging today. I found some things. I’ll update later.
*****
By the by, weren’t those elephants cute?

